shctrl constructs Search Results


99
New England Biolabs f u6 bfp shctr

F U6 Bfp Shctr, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/pmc10950329-275-66-59?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
f u6 bfp shctr - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

96
Addgene inc shctrl vectors

Shctrl Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/10__1172_slash_jci181368-220-30-36?v=Addgene+inc
Average 96 stars, based on 1 article reviews
shctrl vectors - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

92
OriGene kif13a knockdown constructs
(A) Schematic diagram of transport assay utilizing FKBP-tagged BicD2 motor domain, FRB- tagged Kinesin cargo-binding tail domain, and fluorescently-tagged cargo of interest. Upon addition of the rapamycin analogue, FKBP and FRB interact and are co-transported to the centriole. If the protein/vesicle of interest interacts with the Kinesin tail, it is also transported. (B) Representative images of N2a cells expressing RFP-Hrs (red), BicD2-GFP-FKBP (green), and <t>KIF13A-FRB-Myc</t> (blue), +/- rapamycin analogue to induce FKBP/FRB interaction (linker). Size bar, 10 µm. (C) Line scan graphs of the images in panel A , showing that addition of the linker induces colocalization of Hrs with BicD2 and KIF13A as depicted by a single peak in the lower graph. (D-E) Representative images of N2a cells expressing RFP-Hrs (red), BicD2-GFP-FKBP (green), and <t>KIF13B-FRB-Myc</t> (blue), +/- linker ( D ), and corresponding line scan graphs ( E ) showing that addition of linker does not induce Hrs colocalization with BicD2/KIF13B. (F) Immunoblot of lysates from N2a cells coexpressing mCherry or RFP-Hrs together with KIF13A- FRB-Myc or KIF13B-FRB-Myc, immunoprecipitated (IP) with mCherry antibody and probed with Myc or mCherry antibodies. (G) Quantitative analysis of co-immunoprecipitated KIF13A/B, normalized to immunoprecipitated RFP-Hrs and expressed as intensity normalized to KIF13B (****P<0.0001, unpaired t-test, n= 5 independent experiments). Bars show mean ± SEM.
Kif13a Knockdown Constructs, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/bio_rxiv__2020__04__16__044818-167-28-39?v=OriGene
Average 92 stars, based on 1 article reviews
kif13a knockdown constructs - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

96
OriGene negative control shrna
Figure 1. Downregulation of Nup358 expression in cortical neurons. Cortical neurons transfected at 5 DIV, with <t>shRNA</t> constructs co-expressing GFP to downregulate Nup358 (shNup358). As a control, neurons were transfected with a non-targeted shRNA <t>construct</t> <t>(shCTRL).</t> Immunostaining was conducted for Nup358 (red), and the nuclei are labeled with DAPI (blue). Asterisks are used to mark the transfected neuronal cells (green) with a substantial decrease in the Nup358 signal compared to the control untransfected cells. Scale bar: 10 µm.
Negative Control Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/pm37763196-35-1-5?v=OriGene
Average 96 stars, based on 1 article reviews
negative control shrna - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

93
Addgene inc lentiviral constructs plko rfp shctrl
a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
Lentiviral Constructs Plko Rfp Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/bio_rxiv__2025__07__16__665171-165-0-3?v=Addgene+inc
Average 93 stars, based on 1 article reviews
lentiviral constructs plko rfp shctrl - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

86
Merck & Co lentivirus expressing shrna constructs
A RNAi screen for the identification of functional regulator of radiation-induced cell plasticity. A . schematic representation of RNAi screening strategy. B-C . Proportion of ALDH br cells in BFP + ( B ) and RFP + SUM159 cells ( C ) following silencing of each individual gene contained in the RNAi library and normalized with non-targeting <t>siRNA</t> (siCTRL). Genes targeted by a siRNA inducing a significant reduction of the ALDH br cell proportion are highlighted. Statistical test used is Student's t-test. Data represent mean ± SD D . Representative images of the high-content screening captures. ALDEFLUOR cellular staining is represented in green. Dead cells are labeled by DRAQ5 in red. RFP+ cells are in yellow and BFP+ cells in blue. E-F . Validation of candidate genes using FACS analysis. Proportion of ALDH br cells in BFP + ( E ) and RFP + SUM159 cells ( F ) are represented normalized with non-targeting siRNA (siCTRL). siRNA targeting ALDH1A1 was used as positive control and siRNA targeting TEXT12 or VDACL were used as negative control. Statistical test used is Student's t-test. Data represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001.
Lentivirus Expressing Shrna Constructs, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/pmc12325171-221-19-30?v=Merck+%26+Co
Average 86 stars, based on 1 article reviews
lentivirus expressing shrna constructs - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
OriGene rat shrna constructs against nr4a1
A RNAi screen for the identification of functional regulator of radiation-induced cell plasticity. A . schematic representation of RNAi screening strategy. B-C . Proportion of ALDH br cells in BFP + ( B ) and RFP + SUM159 cells ( C ) following silencing of each individual gene contained in the RNAi library and normalized with non-targeting <t>siRNA</t> (siCTRL). Genes targeted by a siRNA inducing a significant reduction of the ALDH br cell proportion are highlighted. Statistical test used is Student's t-test. Data represent mean ± SD D . Representative images of the high-content screening captures. ALDEFLUOR cellular staining is represented in green. Dead cells are labeled by DRAQ5 in red. RFP+ cells are in yellow and BFP+ cells in blue. E-F . Validation of candidate genes using FACS analysis. Proportion of ALDH br cells in BFP + ( E ) and RFP + SUM159 cells ( F ) are represented normalized with non-targeting siRNA (siCTRL). siRNA targeting ALDH1A1 was used as positive control and siRNA targeting TEXT12 or VDACL were used as negative control. Statistical test used is Student's t-test. Data represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001.
Rat Shrna Constructs Against Nr4a1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/pm27221116-76-0-29?v=OriGene
Average 90 stars, based on 1 article reviews
rat shrna constructs against nr4a1 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
OriGene scramble control shrna shctrl
A RNAi screen for the identification of functional regulator of radiation-induced cell plasticity. A . schematic representation of RNAi screening strategy. B-C . Proportion of ALDH br cells in BFP + ( B ) and RFP + SUM159 cells ( C ) following silencing of each individual gene contained in the RNAi library and normalized with non-targeting <t>siRNA</t> (siCTRL). Genes targeted by a siRNA inducing a significant reduction of the ALDH br cell proportion are highlighted. Statistical test used is Student's t-test. Data represent mean ± SD D . Representative images of the high-content screening captures. ALDEFLUOR cellular staining is represented in green. Dead cells are labeled by DRAQ5 in red. RFP+ cells are in yellow and BFP+ cells in blue. E-F . Validation of candidate genes using FACS analysis. Proportion of ALDH br cells in BFP + ( E ) and RFP + SUM159 cells ( F ) are represented normalized with non-targeting siRNA (siCTRL). siRNA targeting ALDH1A1 was used as positive control and siRNA targeting TEXT12 or VDACL were used as negative control. Statistical test used is Student's t-test. Data represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001.
Scramble Control Shrna Shctrl, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/pm32255378-36-12-22?v=OriGene
Average 90 stars, based on 1 article reviews
scramble control shrna shctrl - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
SuperArray Bioscience Corporation rat shctsl constructs
A RNAi screen for the identification of functional regulator of radiation-induced cell plasticity. A . schematic representation of RNAi screening strategy. B-C . Proportion of ALDH br cells in BFP + ( B ) and RFP + SUM159 cells ( C ) following silencing of each individual gene contained in the RNAi library and normalized with non-targeting <t>siRNA</t> (siCTRL). Genes targeted by a siRNA inducing a significant reduction of the ALDH br cell proportion are highlighted. Statistical test used is Student's t-test. Data represent mean ± SD D . Representative images of the high-content screening captures. ALDEFLUOR cellular staining is represented in green. Dead cells are labeled by DRAQ5 in red. RFP+ cells are in yellow and BFP+ cells in blue. E-F . Validation of candidate genes using FACS analysis. Proportion of ALDH br cells in BFP + ( E ) and RFP + SUM159 cells ( F ) are represented normalized with non-targeting siRNA (siCTRL). siRNA targeting ALDH1A1 was used as positive control and siRNA targeting TEXT12 or VDACL were used as negative control. Statistical test used is Student's t-test. Data represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001.
Rat Shctsl Constructs, supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/pm19096818-101-1-6?v=SuperArray+Bioscience+Corporation
Average 90 stars, based on 1 article reviews
rat shctsl constructs - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


Journal: eLife

Article Title: Rho GTPase signaling and mDia facilitate endocytosis via presynaptic actin

doi: 10.7554/eLife.92755

Figure Lengend Snippet:

Article Snippet: To prevent crosstalk between the NLS-RFP and other mCherry constructs, a similar backbone expressing the blue fluorescent protein (BFP) as a reporter was generated in-house by Klaas Ypermann: The backbone was digested by XbaI and PacI , the hSyn1 promotor and mTagBFP (Addgene; #Cat 105772) were amplified with oligos , gel extracted and assembled utilizing a Gibson master mix (New England BioLabs Inc; Cat#E2611L) to yield f(U6) BFP shCTR.

Techniques: Knock-Out, Recombinant, Plasmid Preparation, Variant Assay, Transfection, shRNA, Binding Assay, Mutagenesis, Software, Sequencing

(A) Schematic diagram of transport assay utilizing FKBP-tagged BicD2 motor domain, FRB- tagged Kinesin cargo-binding tail domain, and fluorescently-tagged cargo of interest. Upon addition of the rapamycin analogue, FKBP and FRB interact and are co-transported to the centriole. If the protein/vesicle of interest interacts with the Kinesin tail, it is also transported. (B) Representative images of N2a cells expressing RFP-Hrs (red), BicD2-GFP-FKBP (green), and KIF13A-FRB-Myc (blue), +/- rapamycin analogue to induce FKBP/FRB interaction (linker). Size bar, 10 µm. (C) Line scan graphs of the images in panel A , showing that addition of the linker induces colocalization of Hrs with BicD2 and KIF13A as depicted by a single peak in the lower graph. (D-E) Representative images of N2a cells expressing RFP-Hrs (red), BicD2-GFP-FKBP (green), and KIF13B-FRB-Myc (blue), +/- linker ( D ), and corresponding line scan graphs ( E ) showing that addition of linker does not induce Hrs colocalization with BicD2/KIF13B. (F) Immunoblot of lysates from N2a cells coexpressing mCherry or RFP-Hrs together with KIF13A- FRB-Myc or KIF13B-FRB-Myc, immunoprecipitated (IP) with mCherry antibody and probed with Myc or mCherry antibodies. (G) Quantitative analysis of co-immunoprecipitated KIF13A/B, normalized to immunoprecipitated RFP-Hrs and expressed as intensity normalized to KIF13B (****P<0.0001, unpaired t-test, n= 5 independent experiments). Bars show mean ± SEM.

Journal: bioRxiv

Article Title: Axonal transport of Hrs is activity-dependent and rate limiting for synaptic vesicle protein degradation

doi: 10.1101/2020.04.16.044818

Figure Lengend Snippet: (A) Schematic diagram of transport assay utilizing FKBP-tagged BicD2 motor domain, FRB- tagged Kinesin cargo-binding tail domain, and fluorescently-tagged cargo of interest. Upon addition of the rapamycin analogue, FKBP and FRB interact and are co-transported to the centriole. If the protein/vesicle of interest interacts with the Kinesin tail, it is also transported. (B) Representative images of N2a cells expressing RFP-Hrs (red), BicD2-GFP-FKBP (green), and KIF13A-FRB-Myc (blue), +/- rapamycin analogue to induce FKBP/FRB interaction (linker). Size bar, 10 µm. (C) Line scan graphs of the images in panel A , showing that addition of the linker induces colocalization of Hrs with BicD2 and KIF13A as depicted by a single peak in the lower graph. (D-E) Representative images of N2a cells expressing RFP-Hrs (red), BicD2-GFP-FKBP (green), and KIF13B-FRB-Myc (blue), +/- linker ( D ), and corresponding line scan graphs ( E ) showing that addition of linker does not induce Hrs colocalization with BicD2/KIF13B. (F) Immunoblot of lysates from N2a cells coexpressing mCherry or RFP-Hrs together with KIF13A- FRB-Myc or KIF13B-FRB-Myc, immunoprecipitated (IP) with mCherry antibody and probed with Myc or mCherry antibodies. (G) Quantitative analysis of co-immunoprecipitated KIF13A/B, normalized to immunoprecipitated RFP-Hrs and expressed as intensity normalized to KIF13B (****P<0.0001, unpaired t-test, n= 5 independent experiments). Bars show mean ± SEM.

Article Snippet: To create pFU-EGFP-R183A Hrs-W, an 868 nucleotides fragment of Hrs containing the R183A mutation was synthesized at Genewiz and subcloned into the BsrGI/PshAI sites. shRNA scrambled control and KIF13A knockdown constructs (shCtrl, shKIF13A1 and A2, KIF13B) were purchased from Origene (catalog #TL706020).

Techniques: Transport Assay, Binding Assay, Expressing, Western Blot, Immunoprecipitation

(A-B) Representative images for proximity ligation assay (PLA) in 13-15 DIV hippocampal neurons expressing EGFP ( A ) or EGFP-Hrs ( B ) under control or 2hrs Bic/4AP conditions. PLA puncta (red), representing EGFP-Hrs/KIF13A interactions, were quantified in the soma (white rectangles). Size bar, 10 μm. (C) PLA puncta number per soma, showing a significant increase in Hrs/KIF13A interactions following 2hrs Bic/4AP treatment (*P=0.0129, ****P<0.0001, one-way ANOVA with Sidak’s multiple comparisons test; n=13 for each EGFP control conditions, n=9 for each EGFP-Hrs conditions, ≥3 independent experiments). (D) Immunoblot of lysates from N2a cells coexpressing RFP-Hrs and KIF13A-FRB-Myc, treated with control or high K+ Tyrodes solution for 2hrs, immunoprecipitated (IP) with mCherry antibody and probed with Myc or mCherry antibodies. (E) Quantitative analysis of co-immunoprecipitated KIF13A, normalized to immunoprecipitated RFP-Hrs and expressed as intensity normalized to control condition (*P=0.0249, unpaired t-test, 4 independent experiments). Bars show mean ± SEM.

Journal: bioRxiv

Article Title: Axonal transport of Hrs is activity-dependent and rate limiting for synaptic vesicle protein degradation

doi: 10.1101/2020.04.16.044818

Figure Lengend Snippet: (A-B) Representative images for proximity ligation assay (PLA) in 13-15 DIV hippocampal neurons expressing EGFP ( A ) or EGFP-Hrs ( B ) under control or 2hrs Bic/4AP conditions. PLA puncta (red), representing EGFP-Hrs/KIF13A interactions, were quantified in the soma (white rectangles). Size bar, 10 μm. (C) PLA puncta number per soma, showing a significant increase in Hrs/KIF13A interactions following 2hrs Bic/4AP treatment (*P=0.0129, ****P<0.0001, one-way ANOVA with Sidak’s multiple comparisons test; n=13 for each EGFP control conditions, n=9 for each EGFP-Hrs conditions, ≥3 independent experiments). (D) Immunoblot of lysates from N2a cells coexpressing RFP-Hrs and KIF13A-FRB-Myc, treated with control or high K+ Tyrodes solution for 2hrs, immunoprecipitated (IP) with mCherry antibody and probed with Myc or mCherry antibodies. (E) Quantitative analysis of co-immunoprecipitated KIF13A, normalized to immunoprecipitated RFP-Hrs and expressed as intensity normalized to control condition (*P=0.0249, unpaired t-test, 4 independent experiments). Bars show mean ± SEM.

Article Snippet: To create pFU-EGFP-R183A Hrs-W, an 868 nucleotides fragment of Hrs containing the R183A mutation was synthesized at Genewiz and subcloned into the BsrGI/PshAI sites. shRNA scrambled control and KIF13A knockdown constructs (shCtrl, shKIF13A1 and A2, KIF13B) were purchased from Origene (catalog #TL706020).

Techniques: Proximity Ligation Assay, Expressing, Western Blot, Immunoprecipitation

(A) Representative images and corresponding kymographs of EGFP-Hrs in microfluidically isolated axons expressing shCtrl under control conditions (upper panels) and after 2hrs treatment with Bic/4AP (lower panels)(see Video 8&9). (B) Representative images and corresponding kymographs of EGFP-Hrs in microfluidically isolated axons expressing shKIF13A1 under control conditions (upper panels) and after 2hrs treatment with Bic/4AP (lower panels)(see Video 10&11). Horizontal size bar =10 µm, vertical size bar =25 s. 1 frame taken every 5 s (0.2 fps). Dashed yellow lines highlight axons. (C) Percentage of motile Hrs puncta in axons, showing that shKIF13A1 prevents the increase in motility induced by 2hrs Bic/4AP treatment (***P=0.0004, ns P=0.9985, one-way ANOVA with Sidak’s multiple comparisons test; ≥3 separate experiments, n=14 (shCtrl control), 16 (shCtrl 2hrs Bic/4AP), 16 (shKIF13A1 control), 15 (shKIF13A1 2hrs Bic/4AP) videos/condition). (D) Percentage of motile Hrs puncta in axons expressing shCtrl, shKIF13A2 or shKIF13B under control or 2hrs Bic/4AP treatment. Expression of shKIF13A2, but not shKIF13B, prevents the increase in motility induced by 2hrs Bic/4AP treatment (****P<0.0001, ns P=0.0823, one-way ANOVA with Sidak’s multiple comparisons test; 3 separate experiments, n≥20 videos/condition). Bars show mean ± SEM.

Journal: bioRxiv

Article Title: Axonal transport of Hrs is activity-dependent and rate limiting for synaptic vesicle protein degradation

doi: 10.1101/2020.04.16.044818

Figure Lengend Snippet: (A) Representative images and corresponding kymographs of EGFP-Hrs in microfluidically isolated axons expressing shCtrl under control conditions (upper panels) and after 2hrs treatment with Bic/4AP (lower panels)(see Video 8&9). (B) Representative images and corresponding kymographs of EGFP-Hrs in microfluidically isolated axons expressing shKIF13A1 under control conditions (upper panels) and after 2hrs treatment with Bic/4AP (lower panels)(see Video 10&11). Horizontal size bar =10 µm, vertical size bar =25 s. 1 frame taken every 5 s (0.2 fps). Dashed yellow lines highlight axons. (C) Percentage of motile Hrs puncta in axons, showing that shKIF13A1 prevents the increase in motility induced by 2hrs Bic/4AP treatment (***P=0.0004, ns P=0.9985, one-way ANOVA with Sidak’s multiple comparisons test; ≥3 separate experiments, n=14 (shCtrl control), 16 (shCtrl 2hrs Bic/4AP), 16 (shKIF13A1 control), 15 (shKIF13A1 2hrs Bic/4AP) videos/condition). (D) Percentage of motile Hrs puncta in axons expressing shCtrl, shKIF13A2 or shKIF13B under control or 2hrs Bic/4AP treatment. Expression of shKIF13A2, but not shKIF13B, prevents the increase in motility induced by 2hrs Bic/4AP treatment (****P<0.0001, ns P=0.0823, one-way ANOVA with Sidak’s multiple comparisons test; 3 separate experiments, n≥20 videos/condition). Bars show mean ± SEM.

Article Snippet: To create pFU-EGFP-R183A Hrs-W, an 868 nucleotides fragment of Hrs containing the R183A mutation was synthesized at Genewiz and subcloned into the BsrGI/PshAI sites. shRNA scrambled control and KIF13A knockdown constructs (shCtrl, shKIF13A1 and A2, KIF13B) were purchased from Origene (catalog #TL706020).

Techniques: Isolation, Expressing

(A-C) Representative images of axons expressing mCh-Hrs/shCtrl ( A ), mCh-Hrs/shKIF13A1 ( B ), or mCh-Hrs/shKIF13A2 ( C ) together with EGFP-Synapsin, under control conditions (left panels) or after 20hrs treatment with Bic/4AP (right panels). Size bar, 10 µm. (D) Percentage of Hrs puncta colocalized with Synapsin under the conditions shown in A-C, demonstrating that KIF13A knockdown prevents activity-dependent recruitment of Hrs to SV pools (****P<0.0001, ns P=0.0823, one-way ANOVA with Sidak’s multiple comparisons test; 3 separate experiments, n≥20 videos/condition). (E) Representative immunoblots of SV2 and VAMP2, with corresponding tubulin loading controls, from lysates of 14 DIV hippocampal neurons expressing shCtrl or shKIF13A1 and treated for 24hrs with DMSO control (CON) or cycloheximide (CHX). (F-G) Quantification of the fold-change in SV2 ( F ) and VAMP2 ( G ) degradation under these conditions, calculated as previously described . Degradation of both proteins is significantly decreased in the presence of shKIF13A1 (*P=0.0191 (SV2), *P=0.0161 (VAMP2), unpaired t-test; ≥3 separate experiments, n = 5 (SV2), 11 (VAMP2) cell lysates/condition). All scatter plots show mean ± SEM.

Journal: bioRxiv

Article Title: Axonal transport of Hrs is activity-dependent and rate limiting for synaptic vesicle protein degradation

doi: 10.1101/2020.04.16.044818

Figure Lengend Snippet: (A-C) Representative images of axons expressing mCh-Hrs/shCtrl ( A ), mCh-Hrs/shKIF13A1 ( B ), or mCh-Hrs/shKIF13A2 ( C ) together with EGFP-Synapsin, under control conditions (left panels) or after 20hrs treatment with Bic/4AP (right panels). Size bar, 10 µm. (D) Percentage of Hrs puncta colocalized with Synapsin under the conditions shown in A-C, demonstrating that KIF13A knockdown prevents activity-dependent recruitment of Hrs to SV pools (****P<0.0001, ns P=0.0823, one-way ANOVA with Sidak’s multiple comparisons test; 3 separate experiments, n≥20 videos/condition). (E) Representative immunoblots of SV2 and VAMP2, with corresponding tubulin loading controls, from lysates of 14 DIV hippocampal neurons expressing shCtrl or shKIF13A1 and treated for 24hrs with DMSO control (CON) or cycloheximide (CHX). (F-G) Quantification of the fold-change in SV2 ( F ) and VAMP2 ( G ) degradation under these conditions, calculated as previously described . Degradation of both proteins is significantly decreased in the presence of shKIF13A1 (*P=0.0191 (SV2), *P=0.0161 (VAMP2), unpaired t-test; ≥3 separate experiments, n = 5 (SV2), 11 (VAMP2) cell lysates/condition). All scatter plots show mean ± SEM.

Article Snippet: To create pFU-EGFP-R183A Hrs-W, an 868 nucleotides fragment of Hrs containing the R183A mutation was synthesized at Genewiz and subcloned into the BsrGI/PshAI sites. shRNA scrambled control and KIF13A knockdown constructs (shCtrl, shKIF13A1 and A2, KIF13B) were purchased from Origene (catalog #TL706020).

Techniques: Expressing, Activity Assay, Western Blot

Neuronal firing increases the association of Hrs with plus-end directed kinesin motor protein KIF13A, stimulating the anterograde transport of these vesicles and their delivery to SV pools. Hrs+ vesicles also transport STAM1 and are a subset of Rab5+ early endosomes.

Journal: bioRxiv

Article Title: Axonal transport of Hrs is activity-dependent and rate limiting for synaptic vesicle protein degradation

doi: 10.1101/2020.04.16.044818

Figure Lengend Snippet: Neuronal firing increases the association of Hrs with plus-end directed kinesin motor protein KIF13A, stimulating the anterograde transport of these vesicles and their delivery to SV pools. Hrs+ vesicles also transport STAM1 and are a subset of Rab5+ early endosomes.

Article Snippet: To create pFU-EGFP-R183A Hrs-W, an 868 nucleotides fragment of Hrs containing the R183A mutation was synthesized at Genewiz and subcloned into the BsrGI/PshAI sites. shRNA scrambled control and KIF13A knockdown constructs (shCtrl, shKIF13A1 and A2, KIF13B) were purchased from Origene (catalog #TL706020).

Techniques:

Figure 1. Downregulation of Nup358 expression in cortical neurons. Cortical neurons transfected at 5 DIV, with shRNA constructs co-expressing GFP to downregulate Nup358 (shNup358). As a control, neurons were transfected with a non-targeted shRNA construct (shCTRL). Immunostaining was conducted for Nup358 (red), and the nuclei are labeled with DAPI (blue). Asterisks are used to mark the transfected neuronal cells (green) with a substantial decrease in the Nup358 signal compared to the control untransfected cells. Scale bar: 10 µm.

Journal: Life (Basel, Switzerland)

Article Title: Nucleoporin Nup358 Downregulation Tunes the Neuronal Excitability in Mouse Cortical Neurons.

doi: 10.3390/life13091791

Figure Lengend Snippet: Figure 1. Downregulation of Nup358 expression in cortical neurons. Cortical neurons transfected at 5 DIV, with shRNA constructs co-expressing GFP to downregulate Nup358 (shNup358). As a control, neurons were transfected with a non-targeted shRNA construct (shCTRL). Immunostaining was conducted for Nup358 (red), and the nuclei are labeled with DAPI (blue). Asterisks are used to mark the transfected neuronal cells (green) with a substantial decrease in the Nup358 signal compared to the control untransfected cells. Scale bar: 10 µm.

Article Snippet: Scrambled negative control shRNA (shCTRL, Origene TR30021) and a pool of four mouse gene-specific Nup358 shRNA constructs (shNup358, Origene TL501860) in pGFPC-shLenti Vector (Origene, Rockville, MD, USA) plasmids were used for the knockdown experiments as previously described [14].

Techniques: Expressing, Transfection, shRNA, Construct, Control, Immunostaining, Labeling

a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

Journal: bioRxiv

Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP

doi: 10.1101/2025.07.16.665171

Figure Lengend Snippet: a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

Article Snippet: Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882).

Techniques: Immunofluorescence, Expressing, Sequencing, Plasmid Preparation, Selection

A RNAi screen for the identification of functional regulator of radiation-induced cell plasticity. A . schematic representation of RNAi screening strategy. B-C . Proportion of ALDH br cells in BFP + ( B ) and RFP + SUM159 cells ( C ) following silencing of each individual gene contained in the RNAi library and normalized with non-targeting siRNA (siCTRL). Genes targeted by a siRNA inducing a significant reduction of the ALDH br cell proportion are highlighted. Statistical test used is Student's t-test. Data represent mean ± SD D . Representative images of the high-content screening captures. ALDEFLUOR cellular staining is represented in green. Dead cells are labeled by DRAQ5 in red. RFP+ cells are in yellow and BFP+ cells in blue. E-F . Validation of candidate genes using FACS analysis. Proportion of ALDH br cells in BFP + ( E ) and RFP + SUM159 cells ( F ) are represented normalized with non-targeting siRNA (siCTRL). siRNA targeting ALDH1A1 was used as positive control and siRNA targeting TEXT12 or VDACL were used as negative control. Statistical test used is Student's t-test. Data represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001.

Journal: Theranostics

Article Title: The LRP4/YAP axis drives the radiation-tolerant persister (RTP) cell state in breast cancer

doi: 10.7150/thno.101393

Figure Lengend Snippet: A RNAi screen for the identification of functional regulator of radiation-induced cell plasticity. A . schematic representation of RNAi screening strategy. B-C . Proportion of ALDH br cells in BFP + ( B ) and RFP + SUM159 cells ( C ) following silencing of each individual gene contained in the RNAi library and normalized with non-targeting siRNA (siCTRL). Genes targeted by a siRNA inducing a significant reduction of the ALDH br cell proportion are highlighted. Statistical test used is Student's t-test. Data represent mean ± SD D . Representative images of the high-content screening captures. ALDEFLUOR cellular staining is represented in green. Dead cells are labeled by DRAQ5 in red. RFP+ cells are in yellow and BFP+ cells in blue. E-F . Validation of candidate genes using FACS analysis. Proportion of ALDH br cells in BFP + ( E ) and RFP + SUM159 cells ( F ) are represented normalized with non-targeting siRNA (siCTRL). siRNA targeting ALDH1A1 was used as positive control and siRNA targeting TEXT12 or VDACL were used as negative control. Statistical test used is Student's t-test. Data represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001.

Article Snippet: To evaluate the effect of LRP4 silencing on radiotherapy-response, SUM159, S68, and MDA-MB-231 cells were first transduced with a lentivirus expressing shRNA constructs (shLRP4, #SHCLNV or shCTRL, #SHC201VN (empty vector); Merck Sigma-Aldrich)..Cells shCTRL or shLRP4 were plated at low-density (between 75 and 2000 cells per well, depending on the dose) in 12-well plates (Falcon, 353043), with 3.5mL of culture medium and irradiated between 0 and 6Gy using Synergy linear accelerator (Elekta).

Techniques: Functional Assay, High Content Screening, Staining, Labeling, Biomarker Discovery, Positive Control, Negative Control

LRP4/YAP axis inhibition radiosensitizes iCSC. A-B . Proportion of cells ( A , SUM159; B , S68) presenting a nuclear location of YAP in each cell subpopulations five days post-irradiation, with representative images of YAP staining (in green) in each cell subpopulations on the right panel. Nuclei are counterstained with DAPi (in blue). C . Pre-ranked GSEA interrogating differential expression between iCSC and late non-CSC and YAP/TAZ target genes. D . Western blot of markers related to YAP/TAZ signaling and its activation in SUM159 and S68 cells silenced for LRP4 (shLRP4) compared to the non-targeting shRNA (shCTRL). The mean intensities are indicated below each band for each condition. E . Heat map representing the mRNA expression of the LRP4, ALDH1A1, and YAP/TAZ target genes in SUM159 and S68 silenced for LRP4 (siLRP4) compared to the non-targeting siRNA (siCTRL). Each row represents three independent replicates per conditions (R1, R2, and R3). F . Proportion of SUM159 cells presenting a nuclear location of YAP in late non-CSC and iCSC following LRP4 silencing (siLRP4) compared to a non-targeting siRNA (siCTRL). G-H . SUM159 ( G ) and S68 cells ( H ), following LRP4 silencing (shLRP4) compared to a non-targeting siRNA (shCTRL), were exposed to various dose of radiation therapy and subjected to clonogenic survival assays ( G ), with representative images (right panels). I . Patient-derived xenograft organoid (PDXO) size distribution for CRCM389 cells WT (shCTRL) or silenced for LRP4 (shLRP4) following irradiation (RT) and compared to untreated condition (CTRL) (left panel). Representative pictures of PDXO-CRCM389 7 days post-treatment (right panel). Statistical test used is Student's t-test. Data represent mean ± SD. ns (not significant), *p<0.05, **p<0.01, ***p<0.001. J . Kaplan-Meier tumor-free survival curves of mice xenografted with 100,000-200,000 SUM159 irradiated cells silenced for LRP4 (shLRP4) compared to the control (shCTRL). p-value and hazard ration (HR) estimated according to Log-rank (Mantel-Cox) test.

Journal: Theranostics

Article Title: The LRP4/YAP axis drives the radiation-tolerant persister (RTP) cell state in breast cancer

doi: 10.7150/thno.101393

Figure Lengend Snippet: LRP4/YAP axis inhibition radiosensitizes iCSC. A-B . Proportion of cells ( A , SUM159; B , S68) presenting a nuclear location of YAP in each cell subpopulations five days post-irradiation, with representative images of YAP staining (in green) in each cell subpopulations on the right panel. Nuclei are counterstained with DAPi (in blue). C . Pre-ranked GSEA interrogating differential expression between iCSC and late non-CSC and YAP/TAZ target genes. D . Western blot of markers related to YAP/TAZ signaling and its activation in SUM159 and S68 cells silenced for LRP4 (shLRP4) compared to the non-targeting shRNA (shCTRL). The mean intensities are indicated below each band for each condition. E . Heat map representing the mRNA expression of the LRP4, ALDH1A1, and YAP/TAZ target genes in SUM159 and S68 silenced for LRP4 (siLRP4) compared to the non-targeting siRNA (siCTRL). Each row represents three independent replicates per conditions (R1, R2, and R3). F . Proportion of SUM159 cells presenting a nuclear location of YAP in late non-CSC and iCSC following LRP4 silencing (siLRP4) compared to a non-targeting siRNA (siCTRL). G-H . SUM159 ( G ) and S68 cells ( H ), following LRP4 silencing (shLRP4) compared to a non-targeting siRNA (shCTRL), were exposed to various dose of radiation therapy and subjected to clonogenic survival assays ( G ), with representative images (right panels). I . Patient-derived xenograft organoid (PDXO) size distribution for CRCM389 cells WT (shCTRL) or silenced for LRP4 (shLRP4) following irradiation (RT) and compared to untreated condition (CTRL) (left panel). Representative pictures of PDXO-CRCM389 7 days post-treatment (right panel). Statistical test used is Student's t-test. Data represent mean ± SD. ns (not significant), *p<0.05, **p<0.01, ***p<0.001. J . Kaplan-Meier tumor-free survival curves of mice xenografted with 100,000-200,000 SUM159 irradiated cells silenced for LRP4 (shLRP4) compared to the control (shCTRL). p-value and hazard ration (HR) estimated according to Log-rank (Mantel-Cox) test.

Article Snippet: To evaluate the effect of LRP4 silencing on radiotherapy-response, SUM159, S68, and MDA-MB-231 cells were first transduced with a lentivirus expressing shRNA constructs (shLRP4, #SHCLNV or shCTRL, #SHC201VN (empty vector); Merck Sigma-Aldrich)..Cells shCTRL or shLRP4 were plated at low-density (between 75 and 2000 cells per well, depending on the dose) in 12-well plates (Falcon, 353043), with 3.5mL of culture medium and irradiated between 0 and 6Gy using Synergy linear accelerator (Elekta).

Techniques: Inhibition, Irradiation, Staining, Quantitative Proteomics, Western Blot, Activation Assay, shRNA, Expressing, Derivative Assay, Control